Author Archives: Ylooshi

About Ylooshi

An anthropologist who is an atheist. My blog at breakingspells.net concerns itself with breaking the spells of superstition and religious belief through examining human superstitions and religions scientifically and rationally. Breaking Spells, the blog, also focuses on atheist and secular concerns such as the separation of church and state as well as the negative influences of Islamo-Judeo-Christian religious cults on society.

ATGCTCGAATAAATGTGAATTTGA © 1991 God

Ever wonder what the reason truly is to believe in God? Because he’s perfect at hiding, of course. embedded by Embedded VideoYouTube Direkt

Posted in Christianity, Culture Wars | Tagged , , | Leave a comment

Pareidolia and Anthropomorphism

Christopher Moreau, a 47 year old Canadian man, recently noticed the tree growing in his yard presents the image of “the Virgin Mary.” According to the Sun Media article in the link, the tree: has left dumbfounded residents wondering if … Continue reading

Posted in Scientific Study of Religion | Tagged , , , , | 3 Comments

Making the Move

Breaking Spells is currently under the process of being moved from its original location, hosted by the fine folks at WordPress.com, to this new location, hosted by 1and1.com. The advantages to me would be that I can modify the CSS/HTML … Continue reading

Posted in blogging | Tagged | Leave a comment

Militant Atheism

Vjack has a post on the label of militant atheism over at Atheist Revolution that is definitely worth reading. Be sure to click on the comments link and see what his readers are saying.

Posted in Myths of Atheism, New Atheism | Tagged , | 3 Comments

Creationists dealt a blow in Calif.

I was going to include this with the Sunday Cult Watch since creationism really is a cult (within a cult), fitting the definition leading the Cult Watch post quite well: the adherents of various creationist cults invoke a particular form … Continue reading

Posted in Christianity, Culture Wars, Superstition | Tagged , , , | Leave a comment

Sunday Cult Watch

cult – n. A particular form or system of religious worship; esp. in reference to its external rites and ceremonies. -Oxford English Dictionary, 2nd ed. 1989 This is the recent cult news for the last few weeks. The Catholic Cult … Continue reading

Posted in Cults | Tagged , , , , , | Leave a comment

The Need for Absurd Belief Among Fundamentalists

Why is there a “culture war” between science and religion? Religionists, particularly the more fundamentalist of them, frequently object to scientific facts of evolution, geology, DNA, and so on. They very often assert that very paranormal and supernatural events described … Continue reading

Posted in Culture Wars | Tagged | Leave a comment

Is the United States a Christian Nation

One of the problems with Yahoo! Answers is that once you answer a question, if someone else comes along and follows up with an answer that you’d like to respond to because it is factually incorrect, you can’t. You only … Continue reading

Posted in Christianity, Culture Wars | Tagged , | 1 Comment

The Catholic League Would be a Joke if not so Wretched

“You don’t have a right to go into the street and mock my religion…” That’s a direct quote of William Donohue, the president of the Catholic League. The CL and its loud, ridiculous leader, routinely attack the critics and the … Continue reading

Posted in Culture Wars | Tagged , , | Leave a comment

Creation on the Web and Morality

Codswallop on the Web has an article titled, “Can we be good without god?” To the atheist, this question need not even be answered since we have no gods yet we’re “good.” Sure, there are “bad” atheists. Arguably fewer than … Continue reading

Posted in Christianity, Culture Wars, Myths of Atheism | Tagged , , | Leave a comment