-
-
Recent Posts
Recent Comments
- ylooshi on William Lane Craig: Animals Don’t Suffer; Therefore God Exists
- Thomas Larsen on William Lane Craig: Animals Don’t Suffer; Therefore God Exists
- ylooshi on Of What Use is a Degree in Theology?
- Mark on Of What Use is a Degree in Theology?
- Oscar on Creationists Baffled: Why do their “Facts” Get Shot Down in Forums?
TopPosts
Meta
Tags
apostate atheism atheist Barack Obama belief blasphemy blogging Catholicism catholic league christian Christianity christmas christopher hitchens creation creationism cult cult news culture war Culture Wars evolution god God Delusion godless humanism islam military morality muhammad muslim New Atheism Opposing Views Organizations philosophy politics PZ Myers religion Religion and Spirituality Richard Dawkins rick warren sam harris science science and religion Scientific Study of Religion Superstition United States
Author Archives: Ylooshi
ATGCTCGAATAAATGTGAATTTGA © 1991 God
Ever wonder what the reason truly is to believe in God? Because he’s perfect at hiding, of course. embedded by Embedded VideoYouTube Direkt
Pareidolia and Anthropomorphism
Christopher Moreau, a 47 year old Canadian man, recently noticed the tree growing in his yard presents the image of “the Virgin Mary.” According to the Sun Media article in the link, the tree: has left dumbfounded residents wondering if … Continue reading
Making the Move
Breaking Spells is currently under the process of being moved from its original location, hosted by the fine folks at WordPress.com, to this new location, hosted by 1and1.com. The advantages to me would be that I can modify the CSS/HTML … Continue reading
Militant Atheism
Vjack has a post on the label of militant atheism over at Atheist Revolution that is definitely worth reading. Be sure to click on the comments link and see what his readers are saying.
Creationists dealt a blow in Calif.
I was going to include this with the Sunday Cult Watch since creationism really is a cult (within a cult), fitting the definition leading the Cult Watch post quite well: the adherents of various creationist cults invoke a particular form … Continue reading
Posted in Christianity, Culture Wars, Superstition
Tagged creation, creationism, culture war, science and religion
Leave a comment
Sunday Cult Watch
cult – n. A particular form or system of religious worship; esp. in reference to its external rites and ceremonies. -Oxford English Dictionary, 2nd ed. 1989 This is the recent cult news for the last few weeks. The Catholic Cult … Continue reading
The Need for Absurd Belief Among Fundamentalists
Why is there a “culture war” between science and religion? Religionists, particularly the more fundamentalist of them, frequently object to scientific facts of evolution, geology, DNA, and so on. They very often assert that very paranormal and supernatural events described … Continue reading
Is the United States a Christian Nation
One of the problems with Yahoo! Answers is that once you answer a question, if someone else comes along and follows up with an answer that you’d like to respond to because it is factually incorrect, you can’t. You only … Continue reading
The Catholic League Would be a Joke if not so Wretched
“You don’t have a right to go into the street and mock my religion…” That’s a direct quote of William Donohue, the president of the Catholic League. The CL and its loud, ridiculous leader, routinely attack the critics and the … Continue reading
Creation on the Web and Morality
Codswallop on the Web has an article titled, “Can we be good without god?” To the atheist, this question need not even be answered since we have no gods yet we’re “good.” Sure, there are “bad” atheists. Arguably fewer than … Continue reading
Posted in Christianity, Culture Wars, Myths of Atheism
Tagged Christianity, morality, philosophy
Leave a comment
RSS Comments Feed